| Home | E-Submission | Sitemap | Editorial Office |  
top_img
Korean J Urol Oncol > Volume 19(1); 2021 > Article
마우스 정위성 방광암 모델에서 항미생물 펩타이드의 저항성을 지닌 재조합 Bacillus Calmette-Gué rin의 효과

Abstract

Purpose

Although Mycobacterium bovis Bacillus Calmette-Guérin (BCG) is the most widely used bladder cancer immunotherapy, innate immune responses involving antimicrobial peptides (AMPs) cause BCG failure. Here, we developed genetically modified recombinant BCG (rBCG) strains which escape AMPs and evaluate the efficacy and effects of rBCG.

Materials and Methods

We constructed rBCG strains expressing Streptococcal inhibitor of complement (Sic), which confers resistance to human α-defensin-1 and cathelicidin, and d-alanyl carrier protein ligase (dltA), which confers resistance to cationic AMPs. Sic and dltA were separately cloned into the pMV306 plasmid and introduced into BCG via electroporation. The efficacy of the Sic and dltA gene electroporation into BCG was evaluated by quantitative real-time polymerase chain reaction (qRT-PCR). The internalization rates and anticancer effects of the rBCG strains containing Sic (rBCG-Sic) and dltA (rBCG-dltA) was evaluated by the orthotopic bladder cancer mouse model.

Results

The cycle quantification (C q) values of rBCG-Sic (y=−4.8823 x+13.645, R2=0.9996) and rBCG-dltA (y=−5.438 x+11.641, R2=0.9995) were inverse correlations to the amount of Sic and dltA genes dose dependently. The mean introduction proportions of Sic and dltA genes into BCG by electroporation were 22.2%, 27.5% and showed constant efficacy. In the orthotopic bladder cancer mouse model, the relative internalization number of rBCG-Sic, and rBCG-dltA into bladder cell in mouse bladder were higher than that of BCG and the tumor volume at rBCG-Sic were lower than at BCG and rBCG-dltA at 11, 14 and 18 days.

Conclusions

Our results showed that constructed rBCG-Sic and rBCG-dltA by electroporation and the rBCG-Sic and rBCG-dltA can effectively escape BCG-stimulated AMPs, and significantly improved immunotherapeutic tools to treat bladder cancer in orthotopic bladder cancer mouse model.

서 론

방광암은 전 세계적으로 11번째 발생 빈도를 가진 암으로서, 모든 악성종양 환자의 3% 내지 4%를 차지한다. 전 세계적으로 매년 약 20만 명 이상의 새로운 환자가 발생하며, 이 중에서 15만 명 이상이 남성이다. 방광암은 암의 진행 경과에 따라 표재성 방광암, 침윤성 방광암 및 전이성 방광암으로 구분된다.1 그 중, 표재성 방광암은 TNM 병기에서 Ta, CIS (carcinoma in situ), T1에 해당하는 방광암으로, 전체 방광암의 70% 내지 80%를 차지하며, 약 70%는 Ta 병변이며 나머지 30%가 T1 병기로 진단되는데, 이 중 약 30%가 악성도가 높은 grade 3에 해당한다. 표재성 방광암은 50% 내지 75%의 환자에서 재발하며, 재발한 암의 20% 내지 30%는 보다 높은 병기나 분화도가 나쁜 종양으로 진행되는 것으로 보고되고 있다.2
표재성 방광암의 치료를 위하여, 경요도절제술에 따른 병기 확인 후, 재발 및 진행의 위험도에 따라 경요도절제술 및 방광 내 바실러스 칼메트-게렝균(Bacillus Calmette- Guérin, BCG) 주입법이 일반적으로 시행되고 있다.3 BCG 는 Mycobacterium bovis를 약독화한 생백신으로써, 1976년 Morales 등이 처음으로 방광 내 주입으로 방광암의 재발률을 줄였다는 보고 이후, 비특이적 면역요법제로 널리 사용되고 있다.3 현재까지 BCG의 방광 내 주입요법이 어떠한 작용기전을 통해 항암작용을 나타내는지 명확한 작용기전은 밝혀져 있지 않으나, T cell이 매개하는 면역반응에 의해 발생되는 육아종성 염증반응이 중요한 역할을 하는 것으로 알려져 있다. 즉, BCG 방광 내 주입 시, 방광에서는 BCG를 병원체로 인식하고 이를 저지하기 위하여 선천면역계가 활성화되어 이를 방어하며, 특히 항균 펩타이드(antimicrobial peptides, AMPs)인 베타-디펜신(beta-defensin) 2, 3 및 카텔리시딘(cathelicidin)의 발현이 증가되어 BCG의 사멸을 유도하는 것으로 여겨지고 있다.4
다만, 방광에 주입하는 BCG의 양은 1회에 약 천만(107)개의 colony forming unit이나 실제로 방광표피에 내재화되는 양은 그 중 1% 미만으로 관측되며, 이는 선천면역계의 역할로 BCG의 효용성은 상당히 낮은 것으로 알려져 있다. 즉, 방광 내 상피세포의 방어장벽을 극복하기 위하여 생결핵균인 BCG를 과량으로 방광 내 주입해야 하기 때문에, BCG 주입요법 시 60% 내지 80%의 환자에서 경미한 부작용이, 5%의 환자에서 생명을 위협할 수 있는 심각한 부작용이 발생하는 것으로 알려져 있다.5 이와 같은 부작용으로 인하여 환자의 치료 순응도가 낮아져, 충분한 횟수의 치료를 시행하지 못하고 중도에 치료가 중단되는 일이 빈번하게 발 생한다. 또한, 방광 내 BCG 주입요법을 시행한 환자 중 50% 내지 90%의 환자에서 재발이 발생하고, 20%의 환자에서 근육침윤성방광암으로 진행하는 것으로 보고되고 있으나, BCG 주입요법이 실패한 환자에 대한 2차 치료법은 아직 개발되지 않은 실정이다.6
이를 개선하기 위하여 이 연구자들은 내재화율이 높은 BCG를 개발하기 위한 연구를 수행하였으며 AMPs에 대하여 내성유전자인 Streptococcal inhibitor of complement (Sic)와 d-alanyl carrier protein ligase (dltA)를 발현하는 유전자 재조합 BCG (rBCG-Sic 및 rBCG-dltA)를 개발하였다.7 이 연구에서는 rBCG-Sic 및 rBCG-dltA의 표준화를 위한 실시간 polymerase chain reaction (PCR) 검사를 이용한 수율 측정 및 정위성 방광암 마우스모델을 이용한 실험을 통한 내재화율 및 종양증식억제 효과를 측정하였다.

대상 및 방법

1. BCG 배양 및 플라스미드의 제작

BCG를 배양하기 위한 Middlebrook 7H9 액체 배지는 7H9 분말(BD, Franklin Lakes, NJ, USA)을 dH2 O 및 0.2% 글리세롤(Sigma-Aldrich, St. Louis, MO, USA)과 혼합하여 제조하였다. 배지를 오토클레이브하고 완전히 냉각시킨 후, 필터-살균된 0.05% Tween 80, 및 10% OADC Enrichment 또는 10% ADC Enrichment를 첨가하였다. 약 15일 동안 37℃의 7H9 배지에서 OD600의 광학 밀도가 2.0에 도달할 때까지 BCG를 배양하였다. 그 후, BCG 세포를 phosphate buffered saline (PBS)에서 100의 감염다중도(multiplicity of infection, MOI)를 나타내는 1×107 cells/mL로 희석하고, 사용할 때까지 −80℃에서 보관하였다.
Sic (GenBank: AY229858.1)와 dltA (GenBank: D86240.2)를 이전에 제시한 방법에 의하여 코딩하는 DNA를 합성 및 클로닝하였다(Macrogen, Seoul, Korea).7 EcoRI 및 HpaI 제한효소를 사용하여 pMV306 벡터에서 Sic와 dltA 발현 벡터를 제작하였다(Fig. 1). 클로닝에 사용된 프라이머 서열은 아래와 같다.
Fig. 1.
Recombinant expression vectors used to generate the recombinant Bacillus Calmette-Guérin that express Sic and dltA genes.
kjuo-19-1-40f1.jpg
Sic: forward (pMV306hsp-Sic_F), 5’-CGGGCTGCAGG AATTCATGAAGATCAAGAAGAACATC-3’ and reverse (pMV306hsp-Sic_R), 5’- GATCGTACGCTAGTTAACTC AGGTGGTCGACGGGGTG-3’, dltA: forward (pMV306hsp-dltA_F), 5’-CGGGCTGCAGGAATTCATGACAGATATT ATTAAC-3’ and reverse (pMV306hsp-dltA_R), 5’- GATC GTACGCTAGTTAACTCATCCGTTAATTACCTC-3’.

2. 전기천공법에 따른 재조합 BCG의 제조 및 역전사 PCR을 위한 cDNA의 합성

BCG를 실온에서 7분 동안 3,000×g로 원심분리하여 수득하고, PBS로 2회 세척하였다. 2 mm gap cuvette (BTX, Holliston, MA, USA)은 약 30분 동안 얼음에서 미리 냉각시켜 준비하였다. 1,000 MOI의 BCG를 OADC가 함유된 7H9 액체 배지 100 μ L에 현탁시켰다. 다음으로, BCG를 오토클레이브된 에펜도르프 튜브에서 2 μ g의 플라스미드 DNA와 부드럽게 혼합한 다음, 혼합물을 준비한 gap cuvette 에 첨가하고 2,500 V에서 ECM 399 Electroporation 시스템 (BTX, Holliston, MA, USA)을 사용하여 전기 천공하여 Sic 유전자가 재조합된 BCG (rBCG-Sic)와 dltA 유전자가 재조합된 BCG (rBCG-dltA)를 제조하였다. 그 후, 재조합 BCG 를 ADC 및 가나마이신을 함유하는 7H9 배지에 재현탁시키고, 37℃에서 2일 동안 배양하였다.
전기천공법을 이용해 제조한 재조합 BCG를 37℃에서 3시간 배양한 다음, 실온에서 7분 동안 3,000×g로 원심분리하여 수득하고, PBS로 1회 세척하였다. TRIzol  Max Bacte-rial RNA Isolation Kit (Ambion, Austin, TX, USA)를 사용하여 재조합 BCG 균주에서 총 RNA를 분리하였고, 흡광도 정량 분석방법을 통해 총 RNA의 양을 측정하였다. 분리된 총 RNA중에서 0.5 μ g의 총 RNA를 하기 위해 Sic, dltA 및 16s rRNA 프라이머를 사용하여 역전사 PCR (RT-PCR)에 의해 cDNA를 합성하였으며, 결과는 제조자의 프로토콜 (Takara Bio, Otsu, Shiga, Japan)에 따라 분석하였다. 재조합 BCG의 수율 측정을 위하여, 합성한 cDNA 중 25 ng을 실시간 PCR에서 주형으로 사용하였다. 16s rRNA 프라이머의 서열은 아래와 같다.
16S rRNA: forward (16S rRNA_F), 5’-TCCCGGGCCTT GTACACA-3’ and reverse (16S rRNA_R), 5’- CCACTGG CTTCGGGTGTT-3’.

3. 전기천공법에 따라 제조된 재조합 BCG의 수율 측정

전기천공법을 이용해 제조된 재조합 BCG 내에 발현된 SicdltA 유전자의 양을 측정하기 위하여, 실시간 PCR을 기반으로 하는 정량 방법을 수행하였으며, SicdltA 유전자에 특이적인 프라이머를 사용하여 재조합 BCG에서 발현된 SicdltA 유전자의 양을 측정하였다.
PCR 혼합물(20 μ L)의 조성은 다음과 같다: 1×PCR 버퍼 (0.2 mM dNTP, 2.5 mM MgCl2, 1 mg/mL BSA, 0.5×SYBR Green I 염료 [SIGMA S9430], 0.25U Ex Taq HS), 0.4 μ M 정방향 프라이머, 0.4 μ M 역방향 프라이머 및 25 ng의 주형 DNA. 재조합 BCG의 DNA 증폭은 95℃에서 2분 및 98℃에서 5초 후, 98℃에서 10초, 65℃에서 15초 및 72℃에서 40초를 42사이클 반복하여 수행하였다. DNA 증폭은 각 샘플에 대하여 96-웰 광학 플레이트에서 3회 수행되었다. 실시간 PCR은 CFX96 Touch Real-Time PCR Detection System (Bio-rad Laboratories, Hercules, CA, USA)를 사용하여 수행하였다. 주형 DNA가 없는 대조군과 양성 대조군 DNA를 각 검사에 포함시켰다. SicdltA 유전자에 대한 표준 곡선 작성을 위하여, 플라스미드 DNA를 연속 희석 (10배)하여 각 반응에서 1 pg 내지 100 ng의 DNA를 포함하는 6-포인트 표준 곡선을 작성하였다. 재조합 BCG의 표준 곡선 작성을 위해 BCG의 상보 DNA를 연속 희석 (10배)하여 각 반응에서 1 pg 내지 100 ng의 DNA를 포함하는 6-포인트 표준 곡선을 작성하였다. 전기천공법의 효율성은 실시간 PCR에 사용된 총 상보 DNA 25 ng 대비 SicdltA 유전자의 양으로 계산하였으며, SicdltA 유전자의 표준 곡선을 사용하여 재조합 BCG안에 SicdltA 유전자에 대한 발현량을 결정하였다. 전기천공법의 효율성 측정을 위해 실시간 PCR을 10번 실험하여 평균값을 통해 결정하였다.

4. 방광암 동물모델 구축 및 재조합 BCG 방광 내 주입

방광암 동물모델을 이용한 재조합 BCG의 내재화를 평가하기 위하여, 방광암 동물모델을 구축하고, BCG와 재조합 BCG의 내재화를 비교하였다. 방광암 동물모델은 BALB/c 마우스에 luciferase 발현 MBT2 마우스 방광암 세포주(MBT2/Luc, 2.0×106 cells)를 24 G 카테터를 이용하여 방광 내 주입 후 구축하였다. 대조군, BCG군, rBCG-Sic군과 rBCG-dltA군으로 각 군마다 20마리의 마우스에 방광암을 유발시키고, 그 중, 방광암이 생성된 마우스에 1주일에 2번씩, 3주에 걸쳐 전기천공법을 이용해 만든 재조합 BCG, BCG 혹은 PBS를 방광 내 주입하였다. 3주간의 처리 후에 방광암 조직을 수득하여 재조합 BCG의 내재화 및 방광암의 억제 여부를 평가하였다. 한편, 실험 기간 동안 마우스의 체중에 유의적인 변화는 관찰되지 않았다.

5. 방광암 동물모델에서 방광암 조직의 발광 측정

D-루시페린을 Ca2+ 및 Mg2+을 포함하지 않는 Dulbecco's phosphate-buffered saline (DPBS) 15 mg/mL에 용해시키고, 여과 후 0.22 μ m 주사기 필터를 사용하여 스톡 용액을 제조하였다. 루시페린 용액(DPBS 중 150 mg/kg)을 각 마우스(200 μ L/마우스)에 복강 내 주사하였다. 5분 후, 이소플루란을 사용하여 마우스를 5분 동안 마취시켰다. 발광 신호는 IVIS200 (exposure time: auto, binning: 8, F/stop: 1)을 사용하여 판독되었다. 신호 강도 및 체중을 3일 내지 4일 마다 측정하여 ROI 강도를 모니터링하였다. 발광 이미지는 평균 광도(p/sec/cm2/sr)로 표현된 신호 강도와 함께 광자 모드로 표시되었다. Living Image 소프트웨어(Caliper, PerkinElmer, MA, USA)를 사용하여 데이터를 분석하였다.

6. 마우스 방광암 조직에서 DNA 추출 및 마우스 방광암 조직에서 재조합 BCG의 내재화 측정

PureLink Genomic DNA mini kit (invitrogen, Carlsbad, CA, USA)를 사용하여 마우스 방광암 조직에서 총 게놈 DNA를 분리하였고, 결과는 제조자의 프로토콜에 따라 분석하였다. 흡광도 정량 분석방법을 통해 총 게놈 DNA의 양을 측정하였으며, 정량된 DNA 50 ng을 실시간 PCR에서 주형으로 사용하였다.
DNA에 대하여 정량적 실시간 PCR 기반 방법을 수행하여, 마우스 방광암 조직에서 내재화된 BCG의 양을 결정하였다. 방광암 조직에서 BCG를 검출하기 위하여, 열충격 단백질 유전자(hsp65)를 기반으로 제작한 BCG 특이적 프라이머를 사용하였다. BCG의 DNA를 증폭하기 위하여, hsp65 단편을 표적으로 하였고, 마우스 방광암 조직 DNA 를 증폭하기 위하여, 마우스 GAPDH 유전자를 표적으로 하였으며, 그 프라이머는 Primer-Blast (http://www.ncbi.nlm. nih.gov/tools/primer-blast)로 디자인하였으며, 아래와 같다.
Forward (GAPDH_F), 5’-GCTTAGGTTCATCAGG-3’ and reverse (GAPDH_R), 5’-TTCTTCGGTAGTGACA-3’.
5 mM MgCl2, 1 mg/mL BSA, 0.5×SYBR Green I 염료, 0.25U Ex Taq HS, 0.4 μ M 정방향 프라이머, 0.4 μ M 역방향 프라이머 및 50 ng 주형 DNA. BCG의 DNA 증폭은 95℃에서 2분 및 98℃에서 5초 후, 98℃에서 10초, 60℃에서 15초 및 72℃에서 40초를 42사이클 반복하여 수행하였다. 마우스 암 조직 DNA 증폭은 95℃에서 2분 및 98℃에서 5초 후, 98℃에서 10초, 45℃에서 10초 및 72℃에서 40초를 42사이클 반복하여 수행하였다. DNA 증폭은 각 샘플에 대하여 96-웰 광학 플레이트에서 3회 수행되었다. 실시간 PCR은 CFX96 Touch Real-Time PCR Detection System (Bio-rad Laboratories, Hercules, CA, USA)를 사용하여 수행하였다. 주형 DNA가 없는 대조군과 양성 대조군 DNA를 각 검사에 포함시켰다. BCG에 대한 표준 곡선 작성을 위하여, BCG DNA 스톡을 연속 희석(10배)하여 각 반응에서 1 pg 내지 100 ng의 DNA를 포함하는 6-포인트 표준 곡선을 작성하였다. 마우스 방광암 조직의 표준 곡선 작성을 위해 무처리 방광암 조직군의 DNA를 연속 희석(10배)하여 각 반응에서 1 pg 내지 100 ng의 DNA를 포함하는 6-포인트 표준 곡선을 작성하였다. 두 표준 곡선의 R2 상관관계(correlation)는 0.99였다. 게놈 DNA 카피 수는 DNA의 양 및 게놈 크기를 사용하여 계산하였으며, 표준 곡선을 사용하여 각 샘플의 마우스 방광암 조직에 대한 BCG 세포 수의 비율을 결정하였다.

결 과

1. 재조합 BCG에서 Sic 및 dltA 유전자의 발현 및 수율 측정

전기천공법을 이용해 제조된 재조합 BCG 내에 발현된 SicdltA 유전자의 양을 실시간 PCR을 이용한 대한 표준 곡선 작성하였을 때, cycle quantification (Cq) 값은 rBCG-Sic (y=−4.8823 x+13.645, R2=0.9996) 및 rBCG-dltA (y=−5.438 x+11.641, R2=0.9995)에서 음의 상관관계를 보였다(Fig. 2A). 또한 각각 10개의 rBCG-Sic 및 rBCG-dltA에 대하여 실시간 PCR을 시행하였을 때 통계적으로 차이가 없는 발현량을 보였으며 주입한 유전자에 대하여 rBCG에서의 유전자의 발현비율(mean±standard error [SE], %) 은 Sic 유전자의 경우 22.2±2.77, dltA 유전자의 경우 27.5±1.36이었다(Fig. 2B).
Fig. 2.
Standard curve that shows expression quantity of Sic and dltA genes (A) and the efficacy of the Sic and dltA genes electroporation into Bacillus Calmette-Guérin (B) using by quantitative real-time polymerase chain reaction.
kjuo-19-1-40f2.jpg

2. 정위성 방광암 마우스 모델에서 재조합 BCG의 방광암 억제 효과 확인

정위성 방광암 마우스 모델에서 재조합 BCG의 방광암 억제 효과를 확인하기 위하여, BALB/c 마우스를 이용해 만 든 방광암 동물모델에서 방광암 조직의 발광을 BCG 투여 후 4일, 7일, 11일, 14일 및 18일째에 측정하여 방광암의 크기를 분석하였다. BCG 투여군에서는 처리하지 않은 대조군에 비하여 방광암의 증가율이 낮았으며, 재조합 BCG (rBCG-Sic와 rBCG-dltA) 투여군에서는 방광암의 증식이 BCG군에 비하여 더욱 억제된 것으로 확인되었다(Fig. 3A).
Fig. 3.
Comparison of in vivo antitumor efficacy of Bacillus Calmette-Guérin (BCG) and recombinant BCG in orthotopic bladder cancer mouse model. (A) In vivo imaging via bioluminescence signal, (B) tumor volumes via tumor volume for quantitative comparison (*p<0.05. **p<0.01). rBCG: recombinant BCG.
kjuo-19-1-40f3.jpg
방광암의 크기(mean±SE, ×107 mm3)를 측정하여 방광암 억제 효과를 비교하였을 때, 대조군에 비하여 BCG군에서 11일, 14일, 18일째 방광암의 크기가 통계적으로 작게 관찰되었다(2.98±0.77 vs. 1.99±0.157, p<0.05 at 11th day, 4.14±0.77 vs. 2.54±0.27, p<0.01 at 14th day, 6.14±0.82 vs. 3.04±0.27, p<001 at 18th day) (Fig. 3B). rBCG-dltA군의 경우 11일째에서 BCG군에 비하여 방광암의 크기가 통계적으로 유의한 감소소견을 보였으며(1.28±0.11, p<0.05), rBCG-Sic군의 경우 11일, 14일, 18일째에서 BCG군에 비하여 방광암 크기의 유의한 감소 소견을 보였다(0.47±0.11, p<0.01 at 11th day, 0.96±0.28, p<0.01 at 14th day, 1.03±0.48. p<0.01 at 18th day) (Fig. 3B).

3. 정위성 방광암 마우스 모델에서 재조합 BCG의 방광암 내재화 확인

정위성 방광암 마우스 모델에서 방광 내 rBCG-Sic, rBCG-dltA, BCG 및 PBS (대조군)를 주입 후 방광암 조직을 적출하여 조직 내 BCG 및 rBCG의 양을 정량적 실시간 PCR을 이용하여 측정하고 이를 마우스 방광암 조직에 대한 BCG 수의 비율을 측정하여 내재화율을 측정하였을 때(mean±SE fold), rBCG-Sic (1.38±0.13, p<0.05), rBCG-dltA 군(2.01±0.25, p<0.01)에서 BCG (1.05±0.04) 보다 높은 내재화율을 보였다(Fig. 4).
Fig. 4.
The internalization rate of Bacillus Calmette-Guérin (BCG) and recombinant BCG in mouse bladder cancer tissues in the orthotopic bladder cancer mouse model (*p<0.05. **p<0.01). rBCG: recombinant BCG.
kjuo-19-1-40f4.jpg

고 찰

이 연구에서 rBCG-Sic 및 rBCG-dltA에 대하여 실시간 PCR을 시행하였을 때 통계적으로 차이가 없는 발현량을 보였으며 주입한 유전자에 대하여 rBCG에서의 유전자의 표준화된 발현비율을 구할 수 있었다. 이 연구에서는 단계적으로 희석한 SicdltA 유전자를 이용하여 실시간 PCR을 시행 후 cycle quantification (C q) 값을 측정 후에 음의 상관관계가 있음을 규명하였는데, 이는 초기 DNA의 양이 많을수록 검출 가능한 cycle이 적어진다는 의미이므로 이를 이용하여 유전자의 양을 측정이 가능하며, 결국 BCG에 전기천공법을 수행하였을 때 어느 정도의 유전자에 BCG내에 삽입되었는지 측정할 수 있게 해준다. 이를 이용하여 유전자의 삽입률을 표준화하였으며, 향후 제품화하는데 도움이 될 것으로 생각한다.
유전자재조합 BCG를 개발하는데 있어서 고려하여야 할 사항은 외부에서 추가로 공급된 유전자들이 BCG 유전체의 일부로 안정적으로 유지되어야 한다는 것과 개발될 재조합 BCG가 항생제 내성 유전자를 포함하지 말아야 한다는 점이다. 카나마이신 내성 유전자는 E. coli-Mycobacterium shut-tle 벡터에서 주로 사용되는 선별마커이며, Mycobacterium smegmatisMycobacterium tuberculosis는 카나마이신에 하여 높은 민감성과 낮은 변이율을 나타낸다. 현재 사용되는 mycobacteria 벡터들의 대다수는 Tn5 또는 Tn903에서 유래된 카나마이신 내성 유전자를 이용한다.8,9 그러나 항생제 선택마커는 동물실험에서 플라스미드 벡터의 소실로 재조합 BCG 면역 치료 백신의 개발의 사용에 의문이 제기되고 있으며, 항결핵 약물에 대한 내성을 부여할 수 있다는 점에서도 항생제 선별 marker의 사용에 문제점으로 제시되고 있 다 이 연구에서 사용된 전기천공법을 이용하여 BCG 내로 유전자를 삽입하고, 플라스미드를 이용하여 BCG 염색체의 특정위치에 DNA 절편을 삽입하면서 최종적으로 항생제 내성유전자를 포함하지 않는 재조합 BCG를 제작할 수 있는 기술로 다양한 유전자 재조합 BCG를 개발하는데 사용될 수 있다.
또한 정위성 방광암 마우스 모델에서 방광 내 rBCG-Sic 및 rBCG-dltA를 주입 후 내재화율을 측정하였을 BCG와 비교하여 각각 1.3배, 및 2배가 향상됨을 확인하였다. BCG는 균이기에 우리 몸은 적으로 인식해 선천면역반응을 보이며 공격한다. 요로를 지나며 베타-디펜신 및 카텔리시딘과 같은 항균 펩타이드는 방광에 도달하는 BCG의 수를 줄이게 되므로 이를 극복하기 위해서 많은 양의 BCG를 장기간 주입해야만 하며 이로 인하여 다양한 부작용을 경험하며 이로 인하여 치료를 중단하는 상황이 생기게 된다. 따라서 이 연구에서는 이를 극복하기 위한 방법으로 SicdltA 유전자를 이용하였는데 이는 BCG의 손실을 입히는 항균 펩타이드에 대해 뛰어난 저항성을 보인다. DltA 단백질은 BCG의 세포 벽에 테이코산을 d-alanyl 에스터화시키는데 필수적인 역할을 수행하고 테이코산의 d-alanyl 에스터화는 양전하를 증가시켜 CAMPs와 같은 항균 펩타이드의 효과를 감소시킬 수 있다.10 또한 Streptococcus pyogenes가 만드는 Sic는 항균 펩타이드가 세포막으로 도달하지 못하도록 막는 역할을 하는 친수성의 분비 단백질이다.11 이 연구로 개발된 유전자 재조합 BCG는 방광암 세포에 대해 높은 내재화율을 나타내고, 항균펩티드에 대한 내성이 우수하므로, 종래 BCG 주입요법 시 사용되는 용량보다 낮은 용량으로 방광 내 주입이 가능하여 부작용의 발생을 최소화할 수 있다. BCG의 부작용이 있음에도 불구하고 낮은 내재화율 덕분에 높은 용량의 BCG를 주입해야 하는 것을 생각해보면 내재화율의 증가는 중요한 요소이다. 실제로 임상에서 방광에 BCG를 주입했을 때 방광표피에 내재화 되는 양은 1% 미만으로 관측되기에 유전자 재조합 BCG의 높은 내재화율은 환자에게서 부작용을 줄일 뿐 아니라 치료 순응도 또한 올릴 수 있을 것이라 기대된다.
정위성 방광암 마우스 모델에서 BCG 투여군에서는 대조군에 비하여 방광암의 증가율이 낮았으며, 재조합 BCG (rBCG-Sic와 rBCG-dltA) 투여군에서는 방광암의 증식이 BCG군에 비하여 더욱 억제된 것으로 확인되었다. BCG가 방광암 세포에 내재화 되게 되면 BCG는 기본적으로 우리 몸의 면역체계를 이용해 방광암 세포를 죽이게 되는데, 이 때 관여하는 것으로는 CD4+, CD8+ 림프구, 자연살해세포, 호중구, 대식세포, 수지상세포가 관여하며 BCG는 이러한 면역세포에 분비물질을 통해 방광암 세포의 사멸을 유도한다.12 추가적으로 BCG 자체의 직접적인 세포독성을 통해 방광암 세포를 사멸시키기도 한다.12 형광 측정을 통한 정위성 방광암 마우스 모델에서 BCG 억제 효과가 관찰되었으 나 유전자 재조합 BCG는 더 강력한 항암 효과를 보였으며, 특히 rBCG-Sic에서 가장 높은 항암 효과를 보였다. 이것을 통해 유전자 재조합 BCG가 단순히 세포 실험에서뿐만 아니라 동물모델에서도 유의한 방광암 억제 효과가 있음을 확인할 수 있었다. 이러한 두 결과를 통해 rBCG-Sic와 rBCG-dltA가 향후의 임상 실험에서도 강력한 항암 효과를 낼 것이라고 기대할 수 있다.
BCG는 Mycobacterium bovis에서 만들기 때문에 제약회사가 제어해야 할 BCG 백신의 강도, 품질, 순도 및 효능 등의 여러가지 요소들로 인해 대량생산이 어렵다. 무엇보다도 BCG 백신은 인큐베이션 기간이 길고 전문 장비가 비싸 세균 오염이 발생되기 쉽다. 이러한 요소들은 결국 2012년 BCG 백신 Sanofi 연구소의 폐쇄로 이어졌으며, 이로 인한 BCG 공급의 부족으로 Merck 회사가 겪은 어려움이 지금까지 이어오고 있다.13 고위험 비근침윤성방광암의 치료에서 경요도절제술 후 BCG 방광 내 주입요법을 시행하는 것이 필수적인데, BCG 공급이 부족한 상황에서 이를 극복할 수 있는 방법으로는 (1) BCG의 용량을 1/3–1/2로 줄이고 유지요법의 기간도 1년으로 줄이는 방법, (2) 방광 내 mitomycin C 주입, (3) 방광 내 gemcitabine 주입, (4) 그 외 다른 약제의 방광 내 주입, (5) 조기 근치적방광절제술 등이 가능할 것이다.14 하지만, 여러 고위험 비근침윤성방광암의 연구에서 BCG 방광 내 주입요법의 효과가 가장 우수한 것으로 보고되고 있는 만큼, 현재의 BCG 공급 부족을 해결할 수 있는 대안의 한가지가 소량으로 동일한 내재화율 및 항암 효과를 보일 수 있는 유전자 재조합 BCG의 개발이 현실적인 대안이 될 수 있을 것이다.
임상시험이 아직 시행되지 않은 점 및 실제 효능이 증명되지 않은 점은 유전자 재조합 BCG의 제한이나, 앞서 언급한 실험들은 유전자 재조합 BCG가 개선된 방광암에 대한 항암제가 될 수 있음을 암시한다.

결 론

항균 펩타이드 회피 유전자(SicdltA)를 포함하는 유전자 재조합 BCG는 방광 내 내재율 및 방광암세포의 억제 효과가 우수하고, 저용량으로 동일한 효과를 보여 방광 내 BCG 주입 시 발생할 수 있는 부작용을 최소화할 수 있으므로, 방광암에 대한 항암제 용도로 유용하게 활용할 수 있을 것으로 기대된다.

Conflict of Interest

이해관계 (Conflict of Interest)

저자들은 이 논문과 관련하여 이해관계의 충돌이 없음을 명시합니다.

REFERENCES

1.Burger M, Catto JW, Dalbagni G, Grossman HB, Herr H, Karakiewicz P, et al. Epidemiology and risk factors of urothelial bladder cancer. Eur Urol 2013;63:234–41
crossref pmid
2.Chavan S, Bray F, Lortet-Tieulent J, Goodman M, Jemal A. International variations in bladder cancer incidence and mortality. Eur Urol 2014;66:59–73
crossref pmid
3.Moss JT, Kadmon D. BCG and the treatment of superficial bladder cancer. DICP 1991;25:1355–67
crossref pmid
4.Reddy KV, Yedery RD, Aranha C. Antimicrobial peptides: premises and promises. Int J Antimicrob Agents 2004;24:536–47
crossref pmid
5.Brausi M, Oddens J, Sylvester R, Bono A, van de Beek C, van Andel G, et al. Side effects of Bacillus Calmette-Guerin (BCG) in the treatment of intermediate- and high-risk Ta, T1 papillary carcinoma of the bladder: results of the EORTC genito-urinary cancers group randomised phase 3 study comparing one-third dose with full dose and 1 year with 3 years of maintenance BCG. Eur Urol 2014;65:69–76
crossref pmid
6.Lamm DL, Blumenstein BA, Crawford ED, Montie JE, Scardino P, Grossman HB, et al. A randomized trial of intravesical doxorubicin and immunotherapy with bacille Calmette-Guerin for transitional-cell carcinoma of the bladder. N Engl J Med 1991;325:1205–9
crossref pmid
7.Cho MJ, Kim MJ, Kim K, Choi YW, Lee SJ, Whang YM, et al. The immunotherapeutic effects of recombinant Bacillus Calmette-Guerin resistant to antimicrobial peptides on bladder cancer cells. Biochem Biophys Res Commun 2019;509:167–74
pmid
8.Andrade PM, Chade DC, Borra RC, Nascimento IP, Villanova FE, Leite LC, et al. The therapeutic potential of recombinant BCG expressing the antigen S1PT in the intravesical treatment of bladder cancer. Urol Oncol 2010;28:520–5
crossref pmid
9.Chade DC, Borra RC, Nascimento IP, Villanova FE, Leite LC, Andrade E, et al. Immunomodulatory effects of recombinant BCG expressing pertussis toxin on TNF-alpha and IL-10 in a bladder cancer model. J Exp Clin Cancer Res 2008;27:78
crossref pmid pmc
10.McBride SM, Sonenshein AL. The dlt operon confers resistance to cationic antimicrobial peptides in Clostridium difficile. Microbiology 2011;157:1457–65
crossref
11.Akesson P, Sjoholm AG, Bjorck L. Protein SIC, a novel extracellular protein of Streptococcus pyogenes interfering with complement function. J Biol Chem 1996;271:1081–8
crossref pmid
12.Redelman-Sidi G, Glickman MS, Bochner BH. The mechanism of action of BCG therapy for bladder cancer–a current perspective. Nat Rev Urol 2014;11:153–62
crossref pmid
13.Messing EM. The BCG shortage. Bladder Cancer 2017;3:227–8
crossref pmid pmc
14.Golla V, Lenis AT, Faiena I, Chamie K. Intravesical therapy for non-muscle invasive bladder cancer-current and future options in the age of Bacillus Calmette-Guerin shortage. Rev Urol 2019;21:145–53
pmid pmc
TOOLS
PDF Links  PDF Links
PubReader  PubReader
ePub Link  ePub Link
Full text via DOI  Full text via DOI
Download Citation  Download Citation
CrossRef TDM  CrossRef TDM
  E-Mail
  Print
Share:      
METRICS
0
Crossref
141
View
6
Download
Related article
Editorial Office
Department of Urology, Chung-Ang University Hospital
102 Heukseok-ro, Dongjak-gu, Seoul 06973, Korea
Tel: +82-2-6299-1819   Fax: +82-2-6294-1406   E-mail: journal@kjuo.or.kr
About |  Browse Articles |  Current Issue |  For Authors and Reviewers
Copyright © The Korean Urological Oncology Society and The Korean Prostate Society. All rights reserved.                 Developed in M2PI
Close layer
prev next